Download PDF
Original Article  |  Open Access  |  17 Jul 2023

Evolved distal tail protein of skunaviruses facilitates adsorption to exopolysaccharide-encoding lactococci

Views: 878 |  Downloads: 568 |  Cited:  4
Microbiome Res Rep 2023;2:26.
10.20517/mrr.2023.29 |  © The Author(s) 2023.
Author Information
Article Notes
Cite This Article

Abstract

Aim: Lactococcal skunaviruses are diverse and problematic in the industrial dairy environment. Host recognition involves the specific interaction of phage-encoded proteins with saccharidic host cell surface structures. Lactococcal plasmid pEPS6073 encodes genes required for the biosynthesis of a cell surface-associated exopolysaccharide (EPS), designated 6073-like. Here, the impact of this EPS on Skunavirus sensitivity was assessed.

Methods: Conjugal transfer of pEPS6073 into two model strains followed by phage plaque assays and adsorption assays were performed to assess its effect on phage sensitivity. Phage distal tail proteins were analyzed bioinformatically using HHpred and modeling with AlphaFold. Construction of recombinant phages carrying evolved Dits was performed by supplying a plasmid-encoded template for homologous recombination.

Results: pEPS6073 confers resistance against a subset of skunaviruses via adsorption inhibition. IFF collection skunaviruses that infect strains encoding the 6073-like eps gene cluster carry insertions in their distal tail protein-encoding (dit) genes that result in longer Dit proteins (so-called evolved Dits), which encode carbohydrate-binding domains. Three skunaviruses with classical Dits (no insertion) were unable to fully infect their hosts following the conjugal introduction of pEPS6073, showing reductions in both adsorption and efficiency of plaquing. Cloning the evolved Dit into these phages enabled full infectivity on their host strains, both wild type and transconjugant carrying pEPS6073, with recombinant phages adsorbing slightly better to the EPS+ host than wild type.

Conclusion: The 6073-like EPS potentially occludes the phage receptor for skunaviruses that encode a classical Dit protein. Skunaviruses that infect strains encoding the 6073-like EPS harbor evolved Dits, which likely help promote phage adsorption rather than just allow the phage to circumvent the putative EPS barrier. This work furthers our knowledge of phage-host interactions in Lactococcus and proposes a role for insertions in the Dit proteins of a subset of skunaviruses.

Keywords

Lactococcus, Skunavirus, 936 group bacteriophage, exopolysaccharide, evoDit, dairy fermentations

INTRODUCTION

Lactococcus lactis and Lactococcus cremoris are mesophilic lactic acid bacteria used in starter cultures for dairy fermentations. The long-term utility of highly specialized starter strains is limited by their vulnerability to bacteriophages, including those belonging to the Skunavirus genus (936 group), which are commonly found in the industrial environment[1,2]. Phage infections can cause significant economic loss due to negative end-product quality issues and failed manufacturing processes. Extensive research into lactococcal phage-host interactions has identified a range of phage defenses that can be exploited in industrial strains for improved phage resistance[3-5].

Cell wall polysaccharides (CWPS), encoded by the chromosomal cwps operon (also referred to as rgp operon), decorate the lactococcal cell wall and have been shown to serve as receptors for skunaviruses[4,6-8]. In the initial step of infection, a phage attaches to the cell by binding to its receptor. This attachment, known as phage adsorption, is mediated by phage adhesion modules, which include the C-terminus of the tail tape measure protein, the distal tail protein (Dit), the N-terminal region of the tail-associated lysin (Tal), the receptor binding protein (RBP), and baseplate proteins (BPPs), if present[9-11]. Dit is a major component of the Skunavirus baseplate, and two types of Dit proteins have been found to exist in skunaviruses: classical and long (evolved)[8]. Internal insertions are present in the evolved Dits (evoDits), with the N‐terminal and C‐terminal regions aligning with the full length of the classical Dit. These insertions were found to encode carbohydrate-binding modules (CBMs) and were shown to promote host-binding[8]. In addition to Lactococcus, evoDits have been shown to be involved in phage adsorption in lactobacilli and Bacillus cereus[12]. Analyses showed the Dit-associated CBMs of lactococcal skunaviruses exhibit the same strain specificity as the RBPs and likely recognize a saccharidic component of the CWPS[8]. Indeed, a Dit/RBP/CWPS correlation could be made across subtypes within the Skunavirus genus[8]. Lactococcal evoDits were previously grouped into four classes[8]. Subsequently, an analysis of IFF (formerly DuPont) collection skunaviruses identified as many as 16 distinct groups of Dit insertions[4].

In addition to CWPS, some lactococci also produce exopolysaccharides (EPS), which may be excreted into the growth media or tightly associated with the cell surface[13]. EPS-producing strains are valuable for the desirable textures they produce in fermented dairy products[13]. Additionally, plasmid-encoded EPS biosynthetic capability has been demonstrated to reduce the adsorption of certain phages to the cell, increasing the phage robustness of the strain[14-16]. However, EPS-mediated phage resistance appears to be limited, as many examples of phages infecting EPS-producing lactococcal strains have been reported[17]. Furthermore, we recently identified two subsets of P335-group phages, each of which differentially adsorbed to strains that encode a distinct set of EPS-associated gene clusters[18]. These gene clusters, originally identified on plasmids pEPS6073 and pEPS7127, were designated 6073-like and 7127-like, with further designation of a 6073-like variant (EpsM variant). The 6073-like and 7127-like eps gene clusters were each found to encode genes required for the synthesis of a cell surface-associated EPS, which, we proposed, functions as a receptor for the respective P335 phages[18].

In this study, the work was extended to another problematic phage group, and pEPS6073 was found to provide resistance against a subset of skunaviruses via adsorption inhibition. The IFF phage collection, however, contains several skunaviruses that infect hosts known to harbor the 6073-like eps gene cluster, indicating this resistance does not extend across the entire Skunavirus genus. Here the genetic determinants enabling phages to infect 6073-like EPS+ strains were investigated. Skunaviruses that infect hosts encoding the 6073-like eps gene cluster were found to carry insertions in their distal tail proteins, which encode carbohydrate-binding domains. The relationship between the Dit insertion and EPS+ host was confirmed through the construction of recombinant phages carrying Dit insertions. This work furthers our knowledge of phage-host interactions in Lactococcus and proposes a role for insertions in the Dit proteins of certain skunaviruses.

METHODS

Bacterial strains and phages

Bacterial strains and phages are listed in Table 1. Lactococcal strains were grown at 30 °C in sterile 11% w/v nonfat dry milk (NFDM) or in M17 broth (Oxoid, UK) supplemented with 0.5% lactose or glucose. Escherichia coli was aerobically propagated in LB broth (BD Difco, USA) at 37 °C. When required, antibiotics were added to the media as follows: erythromycin [Em; 5 µg/mL (lactococci), 150 µg/mL (E. coli)].

Table 1

Strains, bacteriophages, and plasmids

Biological materialRelevant characteristicsReference
Bacteria
Lactococcus lactis
1403SSpontaneous SmR derivative of IL1403, plasmid-free[19]
1403S-EPSSmR, EmR, pEPS6073+[18]
1403S-Dit68871403S + pG9Dit6887This study
Lactococcus cremoris
DGCC6071Starter strain 6073-like EPS EpsM var.This study
DGCC6073Starter strain 6073-like EPS typical[18]
DGCC6871Starter strain 6073-like EPS EpsM var.This study
DGCC7168Starter strain 6073-like EPS EpsM var.This study
DGCC7193Starter strain 6073-like EPS EpsM var.This study
DGCC8692Starter strain 6073-like EPS typicalThis study
LM2345Plasmid-free, SpR[20]
2345-EPSSpR, pEPS6073+[18]
2345-Dit6887LM2345 + pG9Dit6887This study
Escherichia coli
TG1 RepA+SupE hsd5 thi ∆(kac-proAB) F’ (traD36 proAB+lacIqlacZ∆M15) with chromosomal copy of pWV01 repA[21]
Bacteriophages
D753Host DGCC6871This study
D970Host DGCC8692This study
D1113Host DGCC8692This study
D2929Host DGCC7168This study
D4006Host DGCC7193This study
D4839Host DGCC6073This study
D4842Host DGCC6071This study
D5604Host DGCC6071This study
D6067Host DGCC8692This study
D6869Host DGCC6073This study
D6875Host DGCC6073This study
D6887Host DGCC6073This study
D6888Host DGCC6073This study
p2Host LM2345[22]
bIL170Host 1403S[23]
P008NCHost 1403S; derivative of P008[24]North Carolina State collection
p2-Dit6887p2 encoding Dit6887This study
bIL170-Dit6887bIL170 encoding Dit6887This study
P008NC-Dit6887P008NC encoding Dit6887This study
Plasmids
pGhost9EmR, temperature sensitive vector[25]
pG9Dit6887pGhost9 + Dit6887This study

The preparation of bacteriophage lysates was performed as previously described[26]. High titer lysates were passed through a 0.45 µm filter and stored at 4 °C. Phage typing was performed using the multiplex PCR method as described by Labrie and Moineau[27]. Spot titer assays and plaque assays were performed as previously described[26] on MRS medium (Oxoid, UK). Briefly, 10-fold serial dilutions in peptone buffer (3M, USA) of phage lysates were prepared. For standard plaque assays, 100 µL of the phage dilution was combined with 150-200 µL of exponentially growing cells (A600 ≈ 0.5) and incubated at room temperature for 10 min. The mixture was added to 3 mL of soft agar overlay (0.5% agar w/v) containing 10 mM CaCl2 and then poured onto a standard MRS agar base plate. For spot assays, exponentially growing cells were added to the soft agar overlay with CaCl2 and then poured onto a base plate. Once solidified, aliquots of the 10-fold serially diluted phage lysates were spotted onto plates. The Efficiency of Plaquing (EOP) is determined by dividing the phage titer on the test host by the titer on the fully sensitive host strain. Results are averaged from three independent replicates.

Phage adsorption tests were performed as previously described[28] on MRS medium. Briefly, phage and exponentially growing cells (absorbance at 600 nm = 0.5) were combined and incubated for 15 min at room temperature. The mixture was then centrifuged (RCF = 9,750 × g at 4 °C) and supernatant assayed for residual phage by standard plaque assay on a sensitive host. Percent adsorption is calculated as: (starting phage titer - residual phage titer)/starting phage titer, and then multiplied by 100. Adsorption on the sensitive host serves as the control against which test strains are compared. Results are averaged from three independent replicates.

PCR, DNA preparation, sequencing, and bioinformatic tools

PCRs were performed with GoTaq® Colorless Master Mix (Promega Corp., USA) or Phusion HF Mastermix (Thermo Scientific, USA) according to the manufacturer’s instructions with 35 cycles of denaturation/annealing/extension. Primer sequences and additional thermocycler conditions are listed in Table 2. Amplicons were purified using the Promega Wizard® SV Gel and PCR Clean-Up System (Promega Corp., USA). Primers were synthesized by Integrated DNA Technologies (USA). Phage DNA was isolated from high-titer phage lysate using Invitrogen PureLink Viral RNA/DNA Mini kit (Life Technologies, USA) according to the manufacturer’s instructions. Phage DNA was sequenced using Illumina technology (Illumina, USA). Sanger sequencing was performed by Eurofins Genomics (USA). Sequences were annotated using RAST or PATRIC RASTtk-enabled Genome Annotation Service[29-31]. Sequences were analyzed using Geneious Prime 2021.0.3 (https://www.geneious.com). Protein analysis was performed using HHpred (Homology detection & structure prediction by HMM-HMM comparison)[32,33].

Table 2

Primer sequences and thermocycler conditions

Primer nameSequence (5’ - 3’)Thermocycler conditions
Clone 6073DIT-FTTCTGGAATGGGATTCAGGACCTAGGGAGGGCTTAATGGAnnealing temperature: 57 °C/extension time: 45 s
Clone 6073DIT-RATCCGTGTCGTTCTGTCCACCATTAAACGAAGTCCGCCTTTC
VF-pG9GTGGACAGAACGACACGGATAnnealing temperature: 55 °C/extension time: 1 min 45 s
VR-pG9TCCTGAATCCCATTCCAGAA
CheckDIT-FCTAGCGGTTACGGTTTAAGCAnnealing temperature: 53 °C/extension time: 1.5 min
CheckDIT-RCCCAYARTTCATARTTAATRAC
p2RPB-FTGTTAGAGCTATCAATTACTGAnnealing temperature: 53 °C/extension time: 30 s
p2RPB-RCCATGTTGCGAA AAGAATCG

Molecular cloning and phage engineering

Development of pG9Dit6887 was performed using NEBuilder® HiFi DNA Assembly (New England Biolabs, USA). PCR amplification of dit was conducted from D6887 phage lysate with primers clone 6073DIT-F and clone 6073DIT-R [Table 2]. A linear amplicon of pGhost9, a vector commonly used for cloning experiments, was created by PCR with primers VF-pG9 and VR-pG9 [Table 2]. Purified Dit amplicon was assembled with purified linear pGhost9 using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, USA) according to the manufacturer’s instructions. Assembly was electroporated into E. coli TG1 RepA+ cells according to the Dower method[34]. Recombinant plasmids were isolated from TG1 RepA+ cells using GeneJET Plasmid Miniprep Kit (Thermo Scientific, USA). Purified plasmid was electroporated into lactococci as previously described[35].

To isolate recombinant phages that have exchanged the wild-type dit for dit6887, phages were propagated on their respective lactococcal host containing pG9Dit6887. With sufficient DNA homology between the respective 5’ and 3’ ends of the wild-type dits and dit6887, recombination between the phages and pG9Dit6887 would occur via double crossover [Supplementary Figure 1]. Selection of recombinant phages was performed by plating the propagations on the respective host + pEPS6073.

Molecular modeling

Molecular modeling of Dit proteins was conducted using the AlphaFold package in monomer mode and employing the fully compiled database of Protein Data Bank (PDB) structures[36]. Predictions were scored based on the pLDDT criteria in order to choose the top-ranked model. Putative carbohydrate-binding domains were predicted using an in-house software package. Structural alignments were carried out using the TM-align algorithm[37]. Visualization of models and preparation of publication-grade figures was conducted within Pymol[38].

Statistical analysis

One-tailed t-tests were conducted for the comparison of adsorption data across recombinant and native phages on the relevant strains. This was carried out using the SciPy package within Python.

RESULTS

pEPS6073 confers resistance against skunaviruses in model lactococci

Lactococcal plasmid pEPS6073 encodes a previously characterized cell surface-associated exopolysaccharide (EPS) correlated to sensitivity to a subgroup of P335 phages[18]. Because plasmid-encoded EPS has been shown to provide phage resistance in lactococci by reducing phage adsorption[14], L. cremoris LM2345 and L. lactis 1403S transconjugants containing pEPS6073 (2345-EPS and 1403S-EPS) were tested against homologous skunaviruses. Plaque assays, which measure the level of phages present that are able to lyse the cell, showed pEPS6073 provided a high level of resistance to each phage as evidenced by a low efficiency of plaquing (EOP) [Table 3]. Adsorption assays, which measure the level of phages that are able to attach to the cells, showed a reduction in adsorption of each phage to the EPS+ transconjugant compared to the fully sensitive parent strain [Table 3].

Table 3

Introduction of pEPS6073 into lactococcal host strains provides resistance against select skunaviruses

PhageStrainEOPAdsorption (%)Comments
p2LM2345189.3 ± 2.1Clear plaques
2345-EPS3.4 × 10-6 (± 3.3 × 10-6)26.0 ± 2.3Turbid plaques
bIL170IL1403S197.7 ± 1.2-
1403S-EPS< 2.9 × 10-943.9 ± 16.6No plaquing, poor bacterial lawn at highest phage titers
P008NCIL1403S195.0 ± 0.9-
1403S-EPS< 1.2 × 10-947.7 ± 10.5No plaquing, poor bacterial lawn/clear at the highest phage titers

Skunaviruses that infect 6073-like EPS+ strains contain insertions in Dit

The IFF collection includes skunaviruses that infect strains, including L. cremoris DGCC6073, that encode the 6073-like eps gene cluster. To determine why these phages are able to infect EPS+ hosts, while pEPS6073 provides a level of resistance against p2, bIL170, and P008NC (a derivative of P008 received from North Carolina State University that shares 97% nucleotide identity with P008), whole genome sequencing was performed on five skunaviruses that infect DGCC6073 and two that infect L. cremoris DGCC6071, a strain that encodes the EpsM variant of the 6073-like eps gene cluster. Examination of the genes encoding the phage distal tail proteins (Dits) found that the skunaviruses infecting DGCC6073 and DGCC6071 contain evolved Dits, which harbor insertions encoding carbohydrate-binding domains. The Dits of the phages infecting DGCC6073 (D4839, D6869, D6875, D6887, and D6888) share > 97% deduced amino acid identity and contain inserts of 168 aa [Supplementary Table 1 and Figure 1]. This Dit insert is consistent with group 14, based on our previous analysis of IFF collection skunaviruses that identified 16 distinct groups of Dit insertions[4]. The Dits of the phages infecting DGCC6071 (D4842 and D5604) share 100% deduced amino acid identity and contain inserts of 319 aa [Supplementary Table 1 and Figure 1], which are consistent with group 7. HHpred analyses of these Dit insertions result in top domain hit 5E7T_B; minor structural protein 5; bacteriophages; Lactococcus lactis. Minor structural protein 5 is identified as ORF 52/BppA in lactococcal phage TUC2009 (accession number NC_002703), a component of the tripod baseplate structure with a putative carbohydrate-binding domain and is involved in receptor binding[39,40]. We observed the presence of sequences in the public domain similar to our group 7 classified Dits, with an average identity of 55%. Through HHpred analysis, the proteins from these phages (62601, 62605, and CHPC958) were also found to be in possession of the 5E7T_B domain.

Evolved distal tail protein of skunaviruses facilitates adsorption to exopolysaccharide-encoding lactococci

Figure 1. Amino acid alignment of representative Dits. Deduced amino acid alignment of the classical Dit from phage p2 and the evolved Dits from representative phages that infect hosts encoding a 6073-like eps gene cluster. Phages that infect strains encoding the typical 6073-like EPS vs. EpsM variant are indicated. In the consensus identity bar, green indicates identity, yellow indicates polymorphism, and red indicates low identity. Dit: distal tail protein; EPS: distal tail protein; EpsM: 6073-like variant.

Additional sequenced IFF collection phages that encode Dits sharing high nucleotide identity to those present in phages infecting DGCC6073 or DGCC6071 were identified (representative translated Dits shown in Figure 1). Each of these phages was found to infect a host that encodes a 6073-like eps gene cluster. Furthermore, the specific Dit insertion was found to correlate to the subtype of the host-encoded 6073-like eps gene cluster: typical (as described on pEPS6073) or the closely related EpsM variant[18]. We previously described the EpsM variant as it resides on pEPS7158[18], and an alignment of the typical vs. EpsM variant eps clusters as they reside on respective plasmids pEPS6073 and pEPS7158 extracted from Millen et al., 2022[18] can be found in Figure 2. The EpsM variant can be distinguished from the typical 6073-like cluster by differences in a set of two glycosyltransferase (GTF) genes found outside of the contiguous eps operon. pEPS6073 contains GTF genes pEPS6073_22 and pEPS6073_24, whereas pEPS7158 contains GTF genes annotated as epsM and epsN[18]. Since GTFs are responsible for linking the sugars of the EPS, and each GTF may have a different substrate specificity[41], the differences in GTF content between the 6073-like strain and its variant likely affect the composition of the EPS.

Evolved distal tail protein of skunaviruses facilitates adsorption to exopolysaccharide-encoding lactococci

Figure 2. Alignment of typical and EpsM variant eps gene clusters as they reside on pEPS6073 and pEPS7158, respectively (Excerpted from Millen et al., 2022[18]). Numbers appearing over gene depictions correspond to locus tags as annotated in GenBank (accession numbers OP323065-OP323068). Genes are colored based on their putative function, including EPS assembly, EPS modulation, glycosyltransferase, transposase, or others. The putative polymerase (wzy), flippase (wzx), and attachment (lytR) genes are annotated as such. Gray bars are used to indicate sequence identity. EPS: Distal tail protein; EpsM: 6073-like variant.

Dits from phages D970, D1113, and D6067, which all infect L. cremoris DGCC8692 (encoding a typical 6073-like eps gene cluster), are ~99% identical at the deduced amino acid level and share 91%-94% pairwise amino acid identity with the Dits of the phages infecting DGCC6073 [Supplementary Table 1 and Figure 1]. The Dits of phages D753, D4006 and D4842, each of which infects a different L. cremoris strain that harbors the EpsM variant 6073-like eps gene cluster (DGCC6871, DGCC7193, or DGCC6071, respectively), share > 99% deduced amino acid identity [Supplementary Table 1]; however, the Dit of D2929, also infecting an L. cremoris strain encoding the EpsM variant EPS (DGCC7168), shares only ~87% deduced amino acid identity with the Dit of the other three phages [Supplementary Table 1 and Figure 1]. Notably, Dits of the phages that infect strains encoding a typical 6073-like EPS share only 58%-62% pairwise amino acid identity with those of the phages that infect strains encoding the EpsM variant EPS. Furthermore, HHpred analyses found that the Dit insertions of the phages infecting hosts that encode the EpsM variant eps gene cluster contain two 5E7T_B domains compared to the single domain encoded by the insertions in the Dits belonging to phages that infect hosts harboring the typical 6073-like eps gene cluster. Representative evolved Dit from D2929 was modeled and compared with the classical Dit from M7361[4] as well as with D6887 [Figure 3]. A clear conservation of the core region from the classical Dit compared to the evolved counterparts can be observed, with the inserts existing as a distinct region connected to the core region via a series of flexible loops. This highlights a modular evolution within the protein, further exemplified when comparing D6887 with D2929, the latter containing two distinctly visible domains within the insert region. Both domains within the D2929 insert region were predicted to contain motifs involved in carbohydrate binding, supporting the HHpred results. The proximal domain was predicted to contain two contiguous regions located at residues 188-259 and 280-321 involved in carbohydrate binding, whereas the distal domain was predicted to contain one such motif across the amino acid range 391-432. With respect to D6887, the absence of the D2929 distal domain is immediately apparent in the structure. Alignments of the proximal domain revealed a 92% structural similarity; however, it was observed that in the case of D6887, only one carbohydrate-binding motif was predicted, corresponding to the one located in the range 188-259 in D2929. The presence of BppA-like domains within the Dits of some phages also represented a point of interest, as the accessory base plate protein (BppA) has been shown to contain CBMs involved in phage binding to the host[8,40,42]. Therefore, a model was constructed of the Dit from phage D4006, predicted to contain this domain, and was compared to the solved structure for TUC2009 (5E7T_B) [Figure 3D]. Indeed, it was observed that there exists a structural similarity between the proximal portion of the insert in the D4006 Dit and 5E7T_B.

Evolved distal tail protein of skunaviruses facilitates adsorption to exopolysaccharide-encoding lactococci

Figure 3. Molecular modeling and comparison of select classical and evolved Dit proteins. Structural alignment of the AlphaFold predicted Dit models for phages D2929 (green) and M7361 (blue), respectively (image A). The region corresponding to the insert present in D2929 is shown on the left-hand side of the figure, with the locations of the three predicted carbohydrate-binding regions (two of them corresponding to the proximal domain and one corresponding to the distal domain) highlighted in different colors. Structural alignment of the D2929 (green) and D6887 (blue) Dit models is provided in panel B on the right-hand side of the figure with an alignment corresponding only to the insert regions provided in panel C at the bottom. The predicted carbohydrate-binding motif in D6887 is highlighted in yellow. Panel D at the bottom right shows a structural alignment of the D4006 Dit protein predicted to possess BppA domains aligned with the minor structural protein 5 (BppA) from the TUC2009 solved baseplate structure (PDB: 5E7T). It can be clearly seen in the proximal portion of the insert in D4006 that there is a structural similarity with BppA. BppA: accessory base plate protein; Dit: distal tail protein; PDB: protein data bank.

Development of recombinant phages

To determine if Dit insertions are necessary for Skunavirus virulence on 6073-like EPS+ strains, three model phages that contain classical Dits (bIL170, P008NC, and p2) were engineered to encode the Dit insertion from D6887. Vector pG9Dit6887, which includes the entire dit sequence from D6887, was assembled in E. coli TG1 RepA+, and the constructed plasmid was then introduced into 1403S and LM2345. Phages p2, P008NC, and bIL170 were propagated on their respective host containing pG9Dit6887 until the culture cleared from phage lysis. Phage lysates were then plaqued on their respective hosts containing pEPS6073. Although pEPS6073 provides a level of resistance to the wild-type phages, titers of these phage propagations on their respective pEPS6073+ host strains were > 1 × 106 pfu/mL with clear plaque morphology, indicating a high level of phages within each of the respective lysates was not inhibited by pEPS6073. A representative single plaque isolate from each of the three plaque assays was propagated on its respective host containing pEPS6073. PCR analysis of each lysate with primers checkDIT-F and checkDIT-R showed an increase in dit size, indicative of an exchange of the D6887 Dit with the native Dits of phages p2, bIL170, and P008NC. Illumina sequencing of recombinant phages p2-Dit6887, bIL170-Dit6887, and P008NC-Dit6887 confirmed the successful integrations of the Dit6887 insertion. Besides the Dit6887, no differences between the bIL170-Dit6887 genome and the published bIL170 genome (AF009630) were found. In addition to the Dit6887, only one SNP (silent mutation in the 3’ end of the putative neck passage structure CDS) was observed in P008NC-Dit6887 compared to the sequence of the P008NC phage lysate used for its development. Three additional SNPs were observed between the p2-Dit6887 genome and the published p2 genome (NC_042024); one intergenic, one silent, and one in the receptor-binding protein (RBP). All three loci in the p2 lysate used for the development of the recombinant phage were confirmed to be consistent with the published genome. As the receptor binding protein is the primary phage antireceptor, the RBP was sequenced in three additional p2-Dit6887 isolates using primers p2RPB-F and p2RPB-R. No mutations were identified in the RBP of these recombinant phage isolates, confirming that RBP mutation is not required for infection on the EPS+ host.

Recombinant phages were plaque assayed on their respective hosts +/- pEPS6073 [Table 4]. The EOPs of P008NC-Dit6887 were roughly equivalent on both isogenic hosts. The EOPs of bIL170-Dit6887 and p2-Dit6887 were both slightly reduced on the pEPS6073- host (< 1 log EOP reduction); however, plaque sizes of all recombinant phages were slightly reduced on the pEPS6073+ host. This data shows that recombinant phages can infect both their EPS-, wild-type host and the respective isogenic EPS+ transconjugant. To determine how the exchanged Dit6887 affects phage adsorption, adsorption assays were performed with P008NC-Dit6887, bIL170-Dit6887, and p2-Dit6887 [Figure 4]. Wild-type phages were only tested on their homologous (fully infective) hosts, but recombinant phages were also tested on non-homologous hosts to determine if the EPS facilitates adsorption when the evolved Dit is present. Recombinant phages showed higher adsorption to their EPS+ host than the EPS- isogenic host. Additionally, recombinant phage adsorption to the EPS- host was reduced compared to that of the wild-type phages. Assays of the recombinant phages on the non-homologous host (p2/1403S, bIL170/LM2345, and P008NC/LM2345) did not show a strong increase in adsorption to the EPS+ strain compared to the EPS- isogenic strain, indicating that the presence of the EPS alone is not sufficient for efficient adsorption [Figure 4].

Evolved distal tail protein of skunaviruses facilitates adsorption to exopolysaccharide-encoding lactococci

Figure 4. Dit promotes phage adsorption to EPS+ strains. (A): Assays on LM2345 and EPS+ transconjugant; (B): Assays on 1403S and EPS+ transconjugant. Adsorption assays were performed with wild-type and recombinant phages on isogenic EPS +/- strains. Wild-type phages adsorbed strongly to their native host, and the introduction of pEPS6073 decreased their adsorption (P < 0.05). Dit exchange resulted in poorer adsorption to each native host but strong adsorption to the pEPS6073+ transconjugant of the native host (P < 0.05). Recombinant phages adsorbed poorly to non-native hosts, although adsorption was slightly increased on the non-native host when pEPS6073 was present (not statistically significant). Statistical comparisons conducted to support the various conclusions have been annotated using connecting lines to explicitly show the pairwise calculations performed. Statistically significant comparisons are marked with asterisks that indicate the level of statistical significance according to the following scale: (* P < 0.05, ** P < 0.01, *** P < 0.001). Comparisons that are not statistically significant are labeled ns. Wild-type phages were not tested against non-native host strains. Average of three independent trials. Dit: Distal tail protein; Error bars: sample standard deviation; EPS: exopolysaccharides.

Table 4

Recombinant phages show expanded host range

EOPPlaque size (mm)
1403S1403S-EPSLM23452345-EPS1403S1403S-EPSLM23452345-EPS
P008NC-Dit68871.08 ± 0.191NANA1.75 ± 0.171.49 ± 0.04NANA
bIL170-Dit68870.36 ± 0.111NANA1.54 ± 0.100.84 ± 0.24NANA
p2-Dit6887NANA0.47 ± 0.461NANA0.64 ± 0.210.54 ± 0.08

DISCUSSION

We recently described lactococcal eps gene clusters that are each associated with sensitivity to a subgroup of P335 phages[18]. One such cluster, designed 6073-like, was originally identified on pEPS6073, and a closely related variant (EpsM variant) with differences in a set of two glycosyltransferases (GTFs) found outside of the contiguous eps operon was subsequently identified[18]. Despite its previous association with sensitivity to a P335 group phage subset, pEPS6073 was found to provide resistance to a subset of skunaviruses in model lactococcal strains. Upon conjugal introduction, pEPS6073 reduced the adsorption of skunaviruses bIL170, P008NC, and p2 to their model host transconjugants. Therefore, adsorption inhibition, at least in part, accounted for this phage resistance phenotype. The majority of the 34.4 kb pEPS6073 encodes the eps gene cluster, mobile elements, and replication functions; however, there is roughly 8 kb of the plasmid that encodes several hypothetical proteins (data not shown). Therefore, it cannot be ruled out that other genes encoded on pEPS6073 could play a role in phage resistance. However, our data are consistent with previous reports of plasmid-encoded EPS providing phage adsorption inhibition and resistance in lactococci[14,16]. This adsorption inhibition is proposed to result from the cell surface-associated EPS occluding the saccharidic cell surface receptor required by the phages[14,16]. Our results are aligned with this proposal, as we have previously shown via electron microscopy that the EPS produced by pEPS6073 is associated with the cell surface[18]. We found that this putative 6073-like EPS-associated phage resistance does not apply to all skunaviruses, as the IFF phage collection contains several that infect strains encoding a 6073-like eps gene cluster (either typical or EpsM variant), including DGCC6073, the native host of pEPS6073. Therefore, we sought to understand why the 6073-like EPS may provide resistance to some, but not all, skunaviruses.

Available genomes of IFF collection skunaviruses that infect 6073-like EPS+ strains were compared to those of bIL170, P008NC, and p2. Noticeably, phages that infect EPS+ strains had insertions in their distal tail proteins, consistent with an evolved Dit. Furthermore, the specific insertion could be correlated to the subtype of the 6073-like eps cluster encoded by the host, typical vs. EpsM variant. This was notable as Dit is a component of the Skunavirus baseplate, which is involved in phage-host interactions[9]. Classical and long (evolved) Dits have been previously described in skunaviruses, with internal insertions present in the evolved Dits found to contain carbohydrate-binding modules (CBMs)[4,8]. Likewise, the Dit inserts identified in this study were also predicted to contain CBMs, which is consistent with the evolved Dits potentially interacting with an EPS. Notably, HHpred analyses identified that the Dit insertions of the phages that infect hosts encoding the typical 6073-like eps gene cluster harbor a single 5E7T_B CBM, while Dit insertions of phages that infect hosts encoding the EpsM variant eps gene cluster contain two 5E7T_B domains. Modeling of representative Dits using AlphaFold further predicted two carbohydrate-binding domains in the D2929 Dit insert, with the proximal domain containing two contiguous regions involved in carbohydrate binding and the distal domain containing only one. In contrast, the Dit insert of D6887 lacked the distal domain and was predicted to encode only one carbohydrate-binding motif in the proximal domain. These differences likely account for the correlation observed between Dit insert and host EPS subtype. We previously showed that despite the differences in GTF content between the 6073-like EPS subtypes, strains encoding either EPS subtype adsorbed a specific subset of P335 group phages at high efficiency[18]. In contrast, this study would suggest that the differences between the EPS produced by the 6073-like eps gene cluster subtypes affect Skunavirus adsorption.

The evolved Dit encoded by D6887 was cloned into phages bIL170, P008NC, and p2. Recombinant phages were tested on their respective isogenic EPS- wild-type and pEPS6073+ transconjugant hosts. While wild-type phages were inhibited on their pEPS6073+ host, displaying hazy plaques and/or reduced EOPs, all recombinant phages formed clear plaques on both wild-type and pEPS6073+ hosts, although plaque size was slightly reduced on EPS+ strains. Recombinant phages were found to plaque with comparable efficiencies on both their EPS+ and EPS- hosts, indicating that the Dit insertion is indeed responsible for overcoming pEPS6073-mediated phage resistance. Furthermore, this demonstrated that the acquisition of the evolved Dit results in an expansion of the host range.

Because the pEPS6073-mediated phage resistance was shown to result, at least in part, from phage adsorption inhibition, adsorption assays were performed using recombinant phages. These assays found that the recombinant phages were able to adsorb at high efficiency to their EPS+ isogenic host, confirming that the Dit insertion enabled the phages to overcome the putative EPS-mediated adsorption inhibition. Adsorption assays were also used to determine if the Dit insertion facilitates phage adsorption rather than just enables the phages to circumvent the putative EPS barrier. Assays found that the adsorption of the recombinant phages to the EPS- host was reduced compared to the adsorption of the wild-type phages, indicating that the recombinant Dit is less suited to interact with the wild-type, EPS- host receptors. Assays also found that the recombinant phages adsorb to the EPS+ host with higher efficiency than the EPS- isogenic host, indicating that the Dit insertion may facilitate adsorption to the putative EPS receptor. However, this is somewhat inconsistent with the adsorption assay results of the recombinant phages on the non-permissive host, which showed only a slight increase in adsorption to the EPS+ strain vs the EPS- isogenic strain. The low efficiency of recombinant phage adsorption to the EPS+ non-permissive host could be due to incompatibilities of the strains’ cell wall polysaccharides (CWPS), which serve as a primary receptor for skunaviruses[7,8]; LM2345 encodes a type C.1 CWPS, while 1403S encodes a type B. This shows that while Dit helps facilitate adsorption to EPS+ strains, other phage and host factors are likely required for efficient adsorption, including the primary receptor/antireceptor (host CWPS/phage-encoded receptor-binding protein[43,44]). CBMs have also been found to decorate various phage structural components in addition to Dit, including the neck passage structures and major tail proteins of skunaviruses[42]. Together, these CBMs were proposed to contribute to phage adsorption by allowing more flexibility in binding orientation or by increasing host binding affinity due to their avidity[42].

This study demonstrates that, like other previously described plasmid-encoded EPS, pEPS6073 reduces adsorption and provides resistance against a subset of skunaviruses. Coupled with our previous study that implicates the same plasmid-encoded EPS in P335 phage sensitivity[18], this work shows the acquisition of EPS can alter a strain’s spectrum of phage sensitivity, providing resistance to some phages but acquiring sensitivity to others. This study found that skunaviruses that were inhibited by pEPS6073 encode classical Dits, while skunaviruses capable of infecting 6073-like EPS+ hosts contain insertions in their Dits that encode carbohydrate-binding domains. Such domains were previously shown to be involved in the host attachment of skunaviruses, likely recognizing a component of the CWPS[8]. This study indicates that a component of EPS is likely recognized by the evoDits encoded by strains that produce a 6073-like EPS, as recombinant phages with Dit6887 show increased adsorption to strains encoding the EPS. However, the EPS is not required for the adsorption of these phages, nor is the EPS alone sufficient to achieve a high level of phage adsorption, indicating additional phage/host factors are required for successful host attachment. This study increases our understanding of phage-host interactions regarding lactococcal EPS, which can be applied to the development of improved dairy starter cultures with increased phage robustness.

DECLARATIONS

Acknowledgments

The authors would like to thank the Moineau lab at Université Laval, Stuart Huntley, Philippe Horvath, and Sabine Schermann for their bioinformatic support. We would also like to thank Christophe Fremaux and Carsten Hansen for the helpful discussion.

Authors’ contributions

Made substantial contributions to the conception and design of the study, performed experiments, and performed data analysis and interpretation: Millen AM, Magill D

Provided administrative, technical, and material support: Romero D, Simdon L

Availability of data and materials

Representative evolved Dit sequences presented in this study have been deposited in the NCBI GenBank repository and can be found at: https://www.ncbi.nlm.nih.gov/genbank/; OR271589-OR271593.

Financial support and sponsorship

None.

Conflicts of interest

The authors are all employees of International Flavors and Fragrances (IFF), a company that produces and markets cultures for industrial dairy applications.

Ethical approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Copyright

© The Authors 2023.

Supplementary Materials

REFERENCES

1. Mahony J, Murphy J, van Sinderen D. Lactococcal 936-type phages and dairy fermentation problems: from detection to evolution and prevention. Front Microbiol 2012;3:335.

2. Oliveira J, Mahony J, Hanemaaijer L, Kouwen TRHM, van Sinderen D. Biodiversity of bacteriophages infecting Lactococcus lactis starter cultures. J Dairy Sci 2018;101:96-105.

3. Samson JE, Moineau S. Bacteriophages in food fermentations: new frontiers in a continuous arms race. Annu Rev Food Sci Technol 2013;4:347-68.

4. Romero DA, Magill D, Millen A, Horvath P, Fremaux C. Dairy lactococcal and streptococcal phage-host interactions: an industrial perspective in an evolving phage landscape. FEMS Microbiol Rev 2020;44:909-32.

5. Charneco G, de Waal PP, van Rijswijck IMH, van Peij NNME, van Sinderen D, Mahony J. Bacteriophages in the dairy industry: a problem solved? Annu Rev Food Sci Technol 2023;14:367-85.

6. Mahony J, Kot W, Murphy J, et al. Investigation of the relationship between lactococcal host cell wall polysaccharide genotype and 936 phage receptor binding protein phylogeny. Appl Environ Microbiol 2013;79:4385-92.

7. Ainsworth S, Sadovskaya I, Vinogradov E, et al. Differences in lactococcal cell wall polysaccharide structure are major determining factors in bacteriophage sensitivity. mBio 2014;5:e00880-14.

8. Hayes S, Vincentelli R, Mahony J, et al. Functional carbohydrate binding modules identified in evolved dits from siphophages infecting various gram-positive bacteria. Mol Microbiol 2018;110:777-95.

9. Sciara G, Bebeacua C, Bron P, et al. Structure of lactococcal phage p2 baseplate and its mechanism of activation. Proc Natl Acad Sci U S A 2010;107:6852-7.

10. Mahony J, Oliveira J, Collins B, et al. Genetic and functional characterisation of the lactococcal P335 phage-host interactions. BMC Genomics 2017;18:146.

11. Goulet A, Spinelli S, Mahony J, Cambillau C. Conserved and diverse traits of adhesion devices from siphoviridae recognizing proteinaceous or saccharidic receptors. Viruses 2020;12:512.

12. Leprince A, Mahillon J. Phage adsorption to gram-positive bacteria. Viruses 2023;15:196.

13. Broadbent JR, McMahon DJ, Welker DL, Oberg CJ, Moineau S. Biochemistry, genetics, and applications of exopolysaccharide production in Streptococcus thermophilus: a review. J Dairy Sci 2003;86:407-23.

14. Forde A, Fitzgerald GF. Analysis of exopolysaccharide (EPS) production mediated by the bacteriophage adsorption blocking plasmid, pCI658, isolated from Lactococcus lactis ssp. cremoris HO2. Int Dairy J 1999;9:465-72.

15. Looijesteijn PJ, Trapet L, de Vries E, Abee T, Hugenholtz J. Physiological function of exopolysaccharides produced by Lactococcus lactis. Int J Food Microbiol 2001;64:71-80.

16. Akçelik M, Şanlibaba P. Characterisation of an exopolysaccharide preventing phage adsorption in Lactococcus lactis subsp. cremoris MA39. Turkish J Vet Anim Sci 2002;26: 1151-6. Available from: https://journals.tubitak.gov.tr/cgi/viewcontent.cgi?article=3309&context=veterinary. [Last accessed on 3 Jul 2023].

17. Deveau H, Van Calsteren MR, Moineau S. Effect of exopolysaccharides on phage-host interactions in Lactococcus lactis. Appl Environ Microbiol 2002;68:4364-9.

18. Millen AM, Romero DA, Horvath P, Magill D, Simdon L. Host-encoded, cell surface-associated exopolysaccharide required for adsorption and infection by lactococcal P335 phage subtypes. Front Microbiol 2022;13:971166.

19. Millen AM, Horvath P, Boyaval P, Romero DA. Mobile CRISPR/Cas-mediated bacteriophage resistance in Lactococcus lactis. PLoS One 2012;7:e51663.

20. Anderson DG, Mckay LL. Genetic and physical characterization of recombinant plasmids associated with cell aggregation and high-frequency conjugal transfer in Streptococcus lactis ML3. J Bacteriol 1984;158:954-62.

21. Duwat P, Cochu A, Ehrlich SD, Gruss A. Characterization of Lactococcus lactis UV-sensitive mutants obtained by ISS1 transposition. J Bacteriol 1997;179:4473-9.

22. Bebeacua C, Tremblay D, Farenc C, et al. Structure, adsorption to host, and infection mechanism of virulent lactococcal phage p2. J Virol 2013;87:12302-12.

23. Coq AM, Cesselin B, Commissaire J, Anba J. Sequence analysis of the lactococcal bacteriophage bIL170: insights into structural proteins and HNH endonucleases in dairy phages. Microbiology 2002;148:985-1001.

24. Mahony J, Deveau H, Mc Grath S, et al. Sequence and comparative genomic analysis of lactococcal bacteriophages jj50, 712 and P008: evolutionary insights into the 936 phage species. FEMS Microbiol Lett 2006;261:253-61.

25. Maguin E, Prévost H, Ehrlich SD, Gruss A. Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J Bacteriol 1996;178:931-5.

26. Terzaghi BE, Sandine WE. Improved medium for lactic streptococci and their bacteriophages. Appl Microbiol 1975;29:807-13.

27. Labrie S, Moineau S. Multiplex PCR for detection and identification of lactococcal bacteriophages. Appl Environ Microbiol 2000;66:987-94.

28. Sanders ME, Klaenhammer TR. Restriction and modification in group N streptococci: effect of heat on development of modified lytic bacteriophage. Appl Environ Microbiol 1980;40:500-6.

29. Aziz RK, Bartels D, Best AA, et al. The RAST server: rapid annotations using subsystems technology. BMC Genomics 2008;9:75.

30. Overbeek R, Olson R, Pusch GD, et al. The SEED and the rapid annotation of microbial genomes using subsystems technology (RAST). Nucleic Acids Res 2014;42:D206-14.

31. Brettin T, Davis JJ, Disz T, et al. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci Rep 2015;5:8365.

32. Zimmermann L, Stephens A, Nam SZ, et al. A completely reimplemented MPI bioinformatics toolkit with a new HHpred server at its core. J Mol Biol 2018;430:2237-43.

33. Gabler F, Nam SZ, Till S, et al. Protein sequence analysis using the MPI bioinformatics toolkit. Curr Protoc Bioinformatics 2020;72:e108.

34. Dower WJ, Miller JF, Ragsdale CW. High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res 1988;16:6127-45.

35. Holo H, Nes IF. High-frequency transformation, by electroporation, of Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl Environ Microbiol 1989;55:3119-23.

36. Jumper J, Evans R, Pritzel A, et al. Highly accurate protein structure prediction with AlphaFold. Nature 2021;596:583-9.

37. Zhang Y, Skolnick J. TM-align: a protein structure alignment algorithm based on the TM-score. Nucleic Acids Res 2005;33:2302-9.

38. DeLano WL. Pymol: an open-source molecular graphics tool. CCP4 Newsl Protein Crystallogr 2002;40:82-92. Available from: https://legacy.ccp4.ac.uk/newsletters/newsletter40/11_pymol.pdf. [Last accessed on 3 Jul 2023]

39. Mc Grath S, Neve H, Seegers JF, et al. Anatomy of a lactococcal phage tail. J Bacteriol 2006;188:3972-82.

40. Legrand P, Collins B, Blangy S, et al. The atomic structure of the phage Tuc2009 baseplate tripod suggests that host recognition involves two different carbohydrate binding modules. mBio 2016;7:e01781-15.

41. Kranenburg R, Vos HR, van Swam II, Kleerebezem M, de Vos WM. Functional analysis of glycosyltransferase genes from Lactococcus lactis and other gram-positive cocci: complementation, expression, and diversity. J Bacteriol 1999;181:6347-53.

42. Hayes S, Mahony J, Vincentelli R, et al. Ubiquitous carbohydrate binding modules decorate 936 lactococcal siphophage virions. Viruses 2019;11:631.

43. McCabe O, Spinelli S, Farenc C, et al. The targeted recognition of Lactococcus lactis phages to their polysaccharide receptors. Mol Microbiol 2015;96:875-86.

44. Murphy J, Bottacini F, Mahony J, et al. Comparative genomics and functional analysis of the 936 group of lactococcal siphoviridae phages. Sci Rep 2016;6:21345.

Cite This Article

Original Article
Open Access
Evolved distal tail protein of skunaviruses facilitates adsorption to exopolysaccharide-encoding lactococci
Anne M. Millen, ... Laura Simdon

How to Cite

Download Citation

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click on download.

Export Citation File:

Type of Import

Tips on Downloading Citation

This feature enables you to download the bibliographic information (also called citation data, header data, or metadata) for the articles on our site.

Citation Manager File Format

Use the radio buttons to choose how to format the bibliographic data you're harvesting. Several citation manager formats are available, including EndNote and BibTex.

Type of Import

If you have citation management software installed on your computer your Web browser should be able to import metadata directly into your reference database.

Direct Import: When the Direct Import option is selected (the default state), a dialogue box will give you the option to Save or Open the downloaded citation data. Choosing Open will either launch your citation manager or give you a choice of applications with which to use the metadata. The Save option saves the file locally for later use.

Indirect Import: When the Indirect Import option is selected, the metadata is displayed and may be copied and pasted as needed.

About This Article

Special Topic

This article belongs to the Special Topic Bacteriophage Ecology, Evolution and Applications
Disclaimer/Publisher’s Note: All statements, opinions, and data contained in this publication are solely those of the individual author(s) and contributor(s) and do not necessarily reflect those of OAE and/or the editor(s). OAE and/or the editor(s) disclaim any responsibility for harm to persons or property resulting from the use of any ideas, methods, instructions, or products mentioned in the content.
© The Author(s) 2023. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, sharing, adaptation, distribution and reproduction in any medium or format, for any purpose, even commercially, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Data & Comments

Data

Views
878
Downloads
568
Citations
4
Comments
0
1

Comments

Comments must be written in English. Spam, offensive content, impersonation, and private information will not be permitted. If any comment is reported and identified as inappropriate content by OAE staff, the comment will be removed without notice. If you have any queries or need any help, please contact us at [email protected].

0
Download PDF
Share This Article
Scan the QR code for reading!
See Updates
Contents
Figures
Related
Microbiome Research Reports
ISSN 2771-5965 (Online)

Portico

All published articles are preserved here permanently:

https://www.portico.org/publishers/oae/

Portico

All published articles are preserved here permanently:

https://www.portico.org/publishers/oae/