Download PDF
Original Article Open Access 13 Aug 2018

Genetic variants of renin on the prevalence of diabetic nephropathy

Views:11054 Downloads:2154 Cited: 2
Vessel Plus 2018;2:19. 10.20517/2574-1209.2018.16
Article Notes

Abstract

Aim: Renin, a component of the Renin-Angiotensin-Aldosterone System (RAAS), is produced in the juxtaglomerular cells of the kidney. It is an important factor for the regulation of blood pressure and electrolyte balance and encoded by the REN gene. Recent studies suggest that the RAAS is a regulator of kidney functions. Individuals with REN variants have been associated with high blood pressure. We substantiated the hypothesis that genetic variants of REN gene have significant association with prevalence of nephropathy and in the development of nephropathy in type 2 diabetes mellitus (T2DM).

Methods: We enrolled to the study 718 consecutive subjects who were registered patients in two individual hospitals in Kolkata city, India. They consisted of 246 (34.26%) T2DM patients without nephropathy cases, 168 (23.40%) type 2 diabetes with nephropathy cases (T2DNH) and 304 (42.34%) healthy controls. Genotypes were assayed with genomic DNA for two known variants of the REN gene, i.e., rs16853055 and rs41317140 using sequencing methods.

Results: Association between the REN gene variants and prevalence of T2DM and T2DNH was tested. A significant association of T2DNH and variant rs41317140 was obtained and it was evident that the rs41317140 (C>T) shows a significant difference between T2DM and T2DNH (X2 = 4.92; P = 0.03; OR = 0.6162; 95% CI: 0.4006-0.948). The results from the multiple model test that additive model predicted the association at genotype level and shows a significant difference between T2DM and T2DNH (OR = 0.6067; P = 0.03). There was no significant association between T2DNH or T2DM and variant rs16853055.

Conclusion: Thus, it is concluded that a genetic variant of the REN gene should have a significant impact on the onset of type 2 diabetic nephropathy.

Keywords

Single nucleotide polymorphismtype 2 diabetes mellitusnephropathyIndian population
Reprints
Download PDF

Introduction

Nephropathy is related to damage or disease of the kidney. Diabetic nephropathy is impairment to the kidney caused by hyperglycemia. In severe cases the kidney can fail. The kidneys filter waste from blood through its capillaries. Diabetes resulting in high blood sugar can destroy these tiny blood vessels (American Diabetes Association). Renal failure or kidney disease in diabetes is intervened by various biochemical pathways such as renin-angiotensin-aldosterone system (RAAS)[1,2], aldose reductase-polyol[3], di-acyl glycerol-protein kinase C[4], advanced glycosylation-end products (AGE)[5,6] and hexosamine pathway[7]. The RAAS regulates blood pressure and water balance. Renin is secreted by the kidneys when blood pressure is low and it stimulates the production of angiotensin (Ang). Ang causes blood vessels to constrict, which results in high blood pressure. Experimental and clinical evidence recommend that the RAAS is a controller of kidney functions and is proposed to play an important role in the progression of nephropathy in type 2 diabetes mellitus[8-10].

Renin is a component of the RAAS and it is a protein containing 406 amino acids together with a pre segment carrying 20-23 and a pro segment of 43-47 amino acids[11-14]. In a number of steps, pro-renin is generated in the juxtaglomerular cells of the kidney by the elimination of 23 amino acids from C-terminus of prepro-renin, and is later converted into mature renin by removal of N-terminal fragment of pro-renin[12,14]. Renin, an aspartyl protease, is encoded by the REN gene and is mapped to 1q25-q32 by in situ hybridization[15]. It spans 12.5 kb in length of DNA and contains 8 introns[16] and encodes 10 exons[17]. It cleaves angiotensinogen and it converts it to Ang I after which, Ang I-converting enzyme (ACE) transforms it into Ang II, a potent vasoconstrictor. The concentrations of angiotensinogen circulating in the blood is abundant and perhaps more than 1000 times in excess of plasma Ang I and Ang II concentrations[18]. Although with exception of some species, activity of renin thus is a key factor for the determination of the rate of Ang I formation in the plasma from enormous supplies of circulating angiotensinogen[19,20]. Therefore, even small relative changes in the rates of Ang I formation perhaps lead to a large absolute difference in the circulating concentrations of Ang II. It is well known that renin is synthesized and stored in substantial quantities in the granules of juxtaglomerular cells and is released in response to various stimuli[20,21]. Thus, large changes in plasma renin levels can rapidly changes the generation of Ang I. Therefore the polymorphism in the promoter region of REN gene may be of great significance in the changes Ang I. Ang I is easily converted to Ang II because the widespread presence of Ang converting enzyme on endothelial cells of many vascular beds including lung[19,20,22]. The resultant increases in plasma Ang II exert powerful actions throughout the body through activation of AGTR1 receptors[20,23]. In this context renin is also an important regulator of blood pressure and electrolyte balance. Individuals with REN polymorphisms have been associated with high blood pressure[24,25], susceptibility to hypertension[26-28] and end-stage renal disease[29].

Keeping the existing body of knowledge in view, the aim of the present study was to investigate the distribution of genotype, allele frequency of REN gene polymorphism and its relationship with type 2 diabetic nephropathy patients in an Eastern Indian population.

Methods

Subjects

Patients were recruited from registered patients list of two participating medical institutions of Kolkata, West Bengal. A standardized protocol was implemented to obtain data from each of the study participants. Ethical committee clearance was obtained from the medical institutions prior to the recruitment of subjects in this study. An informed consent was obtained from all the participants prior to their recruitment for the study.

The study included 168 type 2 diabetic patients with nephropathy cases on hemodialysis (T2DNH), 246 type 2 diabetes patients without nephropathy cases (T2DM) and 304 controls (CON). The identification of type 2 diabetic and nephropathy patients was based on physician’s recommendation or registered patient for dialysis. A detailed medical history of each patient was recorded. The unrelated controls were randomly selected and recruited from local community centers. Participants were born into Bengali families in Kolkata and the surrounding area.

Genotyping

Genomic DNA was prepared from fresh whole blood by using the conventional phenol-chloroform extraction method followed by ethanol precipitation[30]. In this study, previously published primers 5’GCTGTCTTCTGGTGGTACTGCC3’ (sense) and 5’TGCTGGCCATGAACTGGTTCTAGC3’ (antisense) were used for the PCR based detections of single nucleotide polymorphisms (SNPs). PCR amplification was performed in a final volume of 10 μL reaction mixture containing 50 ng of genomic DNA, 20 pmol of each primer, 10X Taq PCR buffer, 25 mM MgCl2, 100 mM of each dNTPs and 0.5 U/uL of Red Taq polymerase. PCR amplification was performed in a DNA thermo cycler (Bio-Rad). PCR was carried out with an initial denaturing time at 95 °C for 5 min. Then the DNA was amplified for 35 cycles with denaturation at 94 °C for 1 min, annealing at 69 °C for 1:30 min and extension at 72 °C for 1:30 min and final extension 72 °C for 10 min. The PCR products were checked by 1% agarose gel electrophoresis with ethidium bromide staining and directly visualized in UV light. Only those PCR products that had a single amplification product with no evidence of non-specific amplification were used for DNA sequencing. The samples were analyzed on ABI 3730 genetic analyzer with a 48 capillary (Applied Biosystems, USA) to generate DNA sequences. Details described in our previous article[31,32].

Statistical analysis

Allele frequencies were calculated for all the SNPs and were tested for Hardy-Weinberg equilibrium (HWE) and allelic association with the disease (Chi-Square test/Fisher exact test). Allelic and genotype association with the phenotypes was tested under different genetic models for both quantitative and qualitative traits by regression analysis and Fisher model test. Allele frequencies were calculated for the SNPs and tested for HWE and allelic association with disease (Fisher exact test, logistic regression and Fisher model tests) using PLINK software[33]. For comparing the allelic distributions between study groups, the odds ratio (OR) with 95% confidence interval (CI) were also calculated. A level of P < 0.05 was assumed statistically significant.

Linkage disequilibrium (LD) between all the SNPs and also for associated SNP’s was estimated using Haploview 4.2 software[34]. The pair wise LD statistics D’ and r2 was calculated for all markers and also for associated SNP’s. The Haploview 4.2 with default program or settings (Gabriel et al.[35], 2002) was used to assess the linkage disequilibrium (D’ and r2) between each pair of SNPs.

Results

The present study has focused on the 5’ region with a special attention to rs41317140 (C to T) mutation. Through DNA sequencing seven SNPs were identified, out of which five new mutations were observed (data are not presented here) and two SNPs have been described previously as rs16853055 and rs41317140[36-39]. The SNP rs16853055 is located at 3879 upstream from the start codon consisting of a C to A mutation. The rs41317140 (TaqI RFLP) is located at 4063 upstream from the start codon in 5’ region with a substitution of C by T mutation. The sequence electropherogram of REN gene presented in Figure 1 for the SNP rs16853055indicating C → A mutation in heterozygote CA condition and the SNP rs41317140 depicted in Figure 2 is indicated with the red arrow, i.e., in heterozygote condition (CT).

Genetic variants of renin on the prevalence of diabetic nephropathy

Figure 1. Sequence electropherogram of Renin gene for the SNP rs16853055

Genetic variants of renin on the prevalence of diabetic nephropathy

Figure 2. Sequence electropherogram of Renin gene for the SNP rs41317140

The genotype data of the Renin gene SNPs are presented in Table 1. The SNP rs16853055 was found among 80 (26.32%) control, 66 (26.83%) T2DM and 34 (20.24%) T2DNH patients, whereas the SNP rs41317140 was observed among 74 (24.34%) control, 64 (26.6%) T2DM and 34 (20.24%) T2DNH patients while homozygote “TT” was found among 2.44% of T2DM patients and 0.66% control.

Table 1

Genotype distribution of RENIN gene variants among the study groups

SNPGenotypeControlT2DMT2DNH
n = 304%n = 246%n = 168%
rs16853055A A20.6662.4421.19
C A8026.326626.833420.24
C C22273.0317470.7313278.57
rs41317140C C22875.0017671.5413479.76
C T7424.346426.023420.24
T T20.6662.4400.00

The results of HWE test are presented in Table 2. From the HWE test it was found that the SNPs rs16853055 and rs41317140 were in HWE, indicating maintenance of allele frequency for control group of the study population. The Fisher exact test for allelic association of rs16853055 and rs41317140 of REN gene is presented in Table 3. From the Fisher exact test, no significant differences were evident in the allele frequencies of the SNP rs16853055 between different combination of study groups that is case and control subjects. However, the rs41317140 (C>T) shows a significant difference between T2DM and T2DNH (X2 = 4.92; P = 0.03; OR = 0.62; 95% CI: 0.4006-0.948) groups, indicating that a person with the SNP rs41317140 (C>T) will develop resistance for T2DM. Logistic regression analysis was performed to confirm the association at different genetic model and the results are presented in Table 4 and exhibit that additive model predicted the association at genotype level and shows significant difference between T2DM and T2DNH groups (OR = 0.61; P = 0.03).

Table 2

Hardy-Weinberg Equilibrium test for rs16853055 (C>A) and rs41317140 (C>T) of RENIN gene among the study groups

SNPAllelesStudy groupsObsHETPredHETHWpvalMAF
rs16853055C:ACON0.2630.2380.09690.138
T2D0.2420.24110.14
T2DM0.2680.26710.159
T2DNH0.2020.20110.113
rs41317140C:TCON0.2430.2240.19290.128
T2D0.2370.230.77630.133
T2DM0.260.26110.154
T2DNH0.2020.1820.31190.101
Table 3

Fisher exact test for allelic association of SNPs rs16853055 (C>A) and rs41317140 (C >T) of RENIN gene among the study groups

SNPA1A2GroupsF_AF_UCHISQP valueORL95U95
rs16853055ACCON vs. T2DM0.15850.13820.8990.341.1750.84151.641
CON vs. T2DNH0.11310.13821.2080.270.79550.52861.197
T2DM vs. T2DNH0.11310.15853.4220.060.67680.44681.025
rs41317140TCCON vs. T2DM0.15450.12831.5480.211.2410.88271.746
CON vs. T2DNH0.10120.12831.520.210.7650.49921.172
T2DM vs. T2DNH0.10120.15454.920.03*0.61620.40060.948
Table 4

Logistic regression analysis of SNPsrs16853055 (C >A) and rs41317140 (C >T) of RENIN gene among the study groups

SNPStudy groupsAdditive modelDominant modelRecessive model
ORL95U95P valueORL95U95P valueORL95U95P value
rs16853055CON vs. T2DM1.180.841.670.321.120.771.620.553.770.7518.870.11
CON vs. T2DNH0.780.511.190.250.730.471.150.181.810.2513.030.55
T2DM vs. T2DNH0.670.441.020.060.650.411.040.070.480.092.410.37
rs41317140CON vs. T2DM1.250.881.770.201.190.811.740.363.770.7518.870.11
CON vs. T2DNH0.740.471.160.190.760.481.200.240.000.00inf0.99
T2DM vs. T2DNH0.610.390.940.03*0.630.391.020.050.000.00inf0.99

It is observed that all three models predicted the association but not to a significant extent for the SNP rs16853055. To the best of our knowledge still there is no literature with respect to any possible role of this polymorphic change with any health problem.

Discussion

The development of diabetic nephropathy is multifactorial[40-43] and genetic predisposition has been anticipated to be an important factor in the development and progression of the disease. Apart from that, hypertension is presumed to be the single most important factor that accelerates the development of diabetic renal disease[25,44,45].

Although the RAAS system has an important function in the controlling blood pressure, maintaining the stable equilibrium of Na+ ion and extracellular fluid volume[46,47], more and more evidence also point out an influence towards the development of diabetic nephropathy. Particular RAAS gene polymorphisms were recognized as risk factors for type 2 diabetes mellitus complications, including hypertension[31], coronary heart disease[48], nephropathy[48-50] and retinopathy[51].

Many researchers have established the importance of tissue RAAS in the heart, vasculature, adrenal glands and brain as well as in the kidney[52,53]. Though each organ system in the body has components of the RAAS, the kidney is unique, because it contains all the elements of the RAAS with compartmentalization in the interstitial networks and tubules as well as intracellular accumulation[54]. In this regard, the adrenal glands along with the kidneys are distinctive because of their tissue concentrations of Ang II, which are much higher than can be explianed by the concentrations transported by the arterial blood flow[55]. There is considerable evidence that the major fraction of Ang II present in renal tissues is greater locally from Ang delivered to the kidney as well as from angiotensinogen locally produced by proximal tubule cells[56,57]. Renin secreted by the juxtaglomerular apparatus cells and delivered to the renal interstitium and vascular compartment appear to be a most powerful controller for producing Ang I from Ang[58,59]. To regulate the production of Ang II, renin is most important, because once Ang I is formed, conversion readily occurs as there are abundant amounts of Ang converting enzyme[54] in circulation. In this regard the genetic variants of REN gene may have a vital role in the regulation of the gene expression as well as the regulation of Ang II production.

Previous findings show that renin gene polymorphism have been associated with diabetic nephropathy[39,60-62], increased risk of vascular complications[25,63], plasma renin activity (PRA)[44], susceptibility to hypertension in a variety of ethnic groups[24,25,27,64,65], T2DM[66,67], and CRI[68] although often with inconsistent results[69,70]. A few studies have reported that the renin rs4131714 (-4063C/T) a promoter variant has no association with DN[39,68,71], whereas the present study found a positive association between rs4131714 (-4063C/T) and T2DNH (P = 0.02655), which shows high linkage disequilibrium (LD) with rs16853055 (D’ = 0.936; LOD = 82.03; r2 = 0.823), [Figure 3]. However, the rs16853055 did not show any significant association with diabetes and diabetic nephropathy diseases. Deinum et al.[39] also reported weak association of REN gene (Bgl I RFLP) polymorphism in the first intron with diabetic nephropathy along with increased level of plasma renin. The first intron is involved in the renin gene transcription regulation[72] and therefore Bgl I RFLP may have some contribution in this regard. Likewise the renin rs4131714 (-4063C/T) promoter variant may also have some regulatory function in the expression of prorenin or renin which is subject to further study. Though we have not measured the level of plasma prorenin or renin which is beyond our scope, but one can illustrate that area. In any future study one can also investigate the precise role of rs16853055 (-3879C/A) polymorphism in connection with diabetic nephropathy, as it shows high linkage disequilibrium with rs4131714 (-4063C/T).

Genetic variants of renin on the prevalence of diabetic nephropathy

Figure 3. Linkage disequilibrium plot of Renin genes SNPs

Genetic sketching of the functional genes helps to explore a particular disease as well as helps to recognize the tendency of that disease within a particular population that may eventually be of support to the doctors for recommending personalized medicine.

The present study has to be taken under consideration within its limitations; that it was limited to a specific ethnic group (Eastern Indian Bengali population). A larger study from different ethnic groups will be needed to confirm for any contribution of renin gene polymor-phism to T2DM complications for development of renal problem or nephropathy. It is also worth mentioning here that this research work only deals with the association study (irrespective of gender) between diabetic nephropathy and the genetic variation of renin gene within its promoter sequence.

Declarations

Acknowledgments

We would like to thank the members of the study populations, patients and control participants for voluntarily taking part in this research work and donating their blood samples and cooperation during data collection. We would also like to thank to Dr. P Roychodhury, (Endocrinologist; Calcutta Medical college and Hospital), Dr. S. Bhattachariya, (Nephrologists; B. P. Poddar Hospital) for their cooperation during Patients selection, registration and medical data collection. We wish to express our deep gratitude to the Director, Anthropological Survey of India, for his kind permission to initiate the work and also for providing financial support.

Authors’ contributions

Involved in the sequencing experiments, screening for gene mutations, performed the statistical analysis as well as participating in the write up of the manuscript: Purkait P

Contributed to preparation of the manuscript: Halder K

Supervised the project: Naidu JM

Supervised the project and compliance with Institutional ethical procedures: Sarkar B

Read and approved the final manuscript: all authors

Availability of data and materials

Reader can ask or mail to corresponding author for materials.

Financial support and sponsorship

This study was funded by the Anthropological Survey of India, Kolkata (fellowship to Dr. Pulakes Purkait as Junior Research Fellowship and Senior Research Fellowship).

Conflicts of interest

All authors declare that there are no conflicts of interest.

Ethical approval and consent to participate

Ethical committee clearance was obtained from the respective medical institutions and Ethical committee of the Anthropological Survey of India, Government of India. Verbal and written well informed consent was obtained from all participants before they were eligible for recruitment into the study.

Consent for publication

Although the manuscript does not involve the use of live photographs of any of the participants, consent was obtained from them for the data to be published as at the time recruitment into the study.

Copyright

© The Author(s) 2018.

REFERENCES

1. Ruggenenti P, Craverdi P, Remuzzi G. The RAAS in the pathogenesis and treatment of diabetic nephropathy. Nature Rev Nephrol 2010;6:319-30.

2. Chawla T, Sharma D, Sing A. Role of renin angiotensin system in diabetic nephropathy. World J Diabetes 2010;1:141-5.

3. Dunlop M. Aldose reductase and the role of polyol pathway in diabetic nephropathy. Kidney Int Suppl 2000;77:S3-12.

4. Noh H, King GL. The role of protein kinase C activation in diabetic nephropathy. Kidney Int Suppl 2007:S49-53.

5. Forbes JM, Cooper ME, Oldfield MD, Thomas MC. Role of advanced glycation end products in diabetic nephropathy. J Am Soc Nephrol 2003;14:S254-8.

6. Buse MG. Hexosamines, insulin resistance and complications of diabetes: current status. Am J Physiol Endocrinol Metab 2006;290:E1-8.

7. Schleicher ED, Weigert C. Role of hexosamine biosynthetic pathwayin diabetic nephropathy. Kidney Int Suppl 2000;77:S13-8.

8. Ruggenenti P, Bettinaglio P, Pinares F, Remuzzi G. Angiotensin converting enzyme insertion/deletion polymorphism and renoprotection in diabetic and nondiabetic nephropathies. Clin J Am Soc Nephrol 2008;3:1511-25.

9. Wang F, Fang Q, Yu N, Zhao D, Zhang Y, Wang J, Wang Q, Zhou X, Cao X, Fan X. Association between genetic polymorphism of the angiotensin converting enzyme and diabetic nephropathy: a meta-analysis comprising 26,580 subjects. J Renin Angiotensin Aldosterone Syst 2012;13:161-74.

10. Rahimi Z, Hasanvand A, Felehgari V. Interaction of MTHFR 1298C with ACE D allele augments the risk of diabetic nephropathy in Western Iran. DNA Cell Biol 2012;31:553-9.

11. Imai T, Miyazaki H, Hirose S, Hori H, Hayashi T, Kageyama R, Ohkubo H, Nakanishi S, Murakami K. Cloning and sequence analysis of cDNA for human renin precursor. Proc Natl Acad Sci U S A 1983;80:7405-9.

12. Hsueh WA, Baxter JD. Human prorenin. Hypertension 1991;17:469-77.

13. Morales R, Watier Y, Böcskei Z. Human prorenin structure sheds light on a novel mechanism of its autoinhibition and on its non-proteolytic activation by the pro(renin) receptor. J Mol Biol 2012;421:100-11.

14. Sparks MA, Crowley SD, Gurley SB, Mirotsou M, Coffman TM. Classical renin-angiotensin system in kidney physiology. Compr Physiol 2014;4:1201-28.

15. McGill JR, Chirgwin JM, Moore CM, McCombs JL. Chromosome localization of the human renin gene (REN) by in situ hybridization. Cytogenet Cell Genet 1987;45:55-7.

16. Hobart PM, Fogliano M, O'Connor BA, Schaefer IM, Chirgwin JM. Human renin gene: structure and sequence analysis. Proc Natl Acad Sci U S A 1984;81:5026-30.

17. Cohen-Haguenauer O, Soubrier F, Van Cong N, Serero S, Turleau C, Jegou C, Gross MS, Corvol P, Frézal J. Regional mapping of the human renin gene to 1q32 by in situ hybridization. Ann Genet 1989;32:16-20.

18. Navar LG, Nishiyama A. Intrarenal formation of angiotensin II. Contrib Nephrol 2001;(135):1-15.

19. Ichihara A, Kobori H, Nishiyama A, Navar LG. Renal renin-angiotensin system. Contrib Nephrol 2004;143:117-30.

20. Paul M, Poyan Mehr A, Kreutz R. Physiology of local renin-angiotensin systems. Physiol Rev 2006;86:747-803.

21. Schweda F, Kurtz A. Cellular mechanism of renin release. Acta Physiol Scand 2004;181:383-90.

22. Navar LG. The kidney is blood pressure regulation and development of hypertension. Med Clin North Am 1997;81:1165-98.

23. Timmermans PB, Wong PC, Chiu AT, Herblin WF, Benfield P, Carini DJ, Lee RJ, Wexler RR, Saye JA, Smith RD. Angiotensin II receptors and angiotensin II receptor antagonists. Pharmacol Rev 1993;45:205-51.

24. Moore N, Dicker P, O'Brien JK, Stojanovic M, Conroy RM, Treumann A, O'Brien ET, Fitzgerald D, Shields D, Stanton AV. Renin gene polymorphisms and haplotypes, blood pressure, and responses to renin-angiotensin system inhibition. Hypertension 2007;50:340-7.

25. Mansego ML, Redon J, Marin R, González-Albert V, Martin-Escudero JC, Fabia MJ, Martinez F, Chaves FJ. Renin polymorphisms and haplotypes are associated with blood pressure levels and hypertension risk in postmenopausal women. J Hypertens 2008;26:230-7.

26. Ahmad U, Saleheen D, Bokhari A, Frossard PM. Strong association of a renin intronic dimorphism with essential hypertension. Hypertens Res 2005;28:339-44.

27. Frossard PM1 PM, Malloy MJ, Lestringant GG, Kane JP. Haplotypes of the human renin gene associated with essential hypertension and stroke. J Hum Hypertens 2001;15:49-55.

28. Chiang FT, Hsu KL, Tseng CD, Lo HM, Chern TH, Tseng YZ. Association of the renin gene polymorphism with essential hypertension in a Chinese population. Clin Genet 1997;51:370-4.

29. Sarkar S, Gupta V, Kumar A, Chaudhary M, Diyundi S, Sehajpal PK, Thangaraj K, Rajender S. M235T polymorphism in the AGT gene and A/GI8-83 substitution in the REN gene correlate with end-stage renal disease. Nephron 2015;129:104-8.

30. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215.

31. Purkait P, Halder K, Thakur S, Ghosh Roy A, Raychaudhuri P, Bhattacharya S, Sarkar BN, Naidu JM. Association of angiotensinogen gene SNPs and haplotypes with risk of hypertension in eastern Indian population. Clin Hypertens 2017;23:12.

32. Purkait P, Roy AG, Halder K, Suthar P, Raychaudhuri P, Bhattacharya S, Sarkar BN, Naidu JM. Sex-based association of CYP11B2 (-344 C/T) polymorphism in Indian type 2 diabetic patients. Int J Diabetol Vasc Dis Res 2015;3:89-93.

33. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA, Bender D, Maller J, Sklar P, de Bakker PI, Daly MJ, Sham PC. PLINK: a toolset for whole-genome association and population-based linkage analysis. Am J Hum Genet 2007;81:559-75.

34. Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 2005;21:263-5.

35. Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, Blumenstiel B, Higgins J, DeFelice M, Lochner A, Faggart M, Liu-Cordero SN, Rotimi C, Adeyemo A, Cooper R, Ward R, Lander ES, Daly MJ, Altshuler D. The structure of haplotype blocks in the human genome. Science 2002;296:2225-9.

36. Frossard PM, Gonzalez PA, Fritz LC, Ponte PA, Fiddes JC, Atlas SA. Two RFLPs at the human renin (ren) gene locus. Nucleic Acids Res 1986;14:4380.

37. Frossard PM, Lestringant GG, Malloy MJ, Kane JP. Human renin gene BglI dimorphism associated with hypertension in two independent populations. Clin Genet 1999;56:428-33.

38. Naftilan AJ, Williams R, Burt D, Paul M, Pratt RE, Hobart P, Chirgwin J, Dzau VJ. A lack of genetic linkage of renin gene restriction fragment length polymorphisms with human hypertension. Hypertension 1989;14:614-8.

39. Deinum J, Tarnow L, van Gool JM, de Bruin RA, Derkx FH, Schalekamp MA, Parving HH. Plasma renin and prorenin and renin gene variation in patients with insulin-dependent diabetes mellitus and nephropathy. Nephrol Dial Transplant 1999;14:1904-11.

40. Hasegawa G, Nakano K, Sawada M, Uno K, Shibayama Y, Ienaga K, Kondo M. Possible role of tumor necrosis factor and interleukin-1 in the development of diabetic nephropathy. Kidney Int 1991;40:1007-12.

41. Heesom AE, Hibberd ML, Millward A, Demaine AG. Polymorphism in the 5'-end of the aldose reductase gene is strongly associated with the development of diabetic nephropathy in type1 diabetes. Diabetes 1997;46:287-91.

42. Parving HH, Lehnert H, Bröchner-Mortensen J, Gomis R, Andersen S, Arner P; Irbesartan in Patients with Type 2 Diabetes and Microalbuminuria Study Group. The effect of irbesartanon the development of diabetic nephropathy in patient with type 2 diabetes. N Engl J Med 2001;345:870-8.

43. Purkait P, Halder K, Roy AG, Sarkar BN, Naidu JM. GSTM1 null genotype associated with type 2 diabetic nephropathy patients among Indian population. World J Pharm Res 2014;3:4452-63.

44. Hasimu B, Nakayama T, Mizutani Y, Izumi Y, Asai S, Soma M, Kokubun S, Ozawa Y. Haplotype analysis of the human renin gene and essential hypertension. Hypertension 2003;41:308-12.

45. Viswanathan V. Prevention of diabetic nephropathy: a diabetologist's perspective. Indian J Nephrol 2004;14:157-62.

46. O'Donnell CJ, Lindpaintner K, Larson MG, Rao VS, Ordovas JM, Schaefer EJ, Myers RH, Levy D. Evidence for association and genetic linkage of the angiotensin-converting enzyme locus with hypertension and blood pressure in men but not women in the Framingham Heart Study. Circulation 1998;97:1766-72.

47. Manrique C, Lastra G, Gardner M, Sowers JR. The renin angiotensin aldosterone system in hypertension: roles of insulin resistance and oxidative stress. Med Clin North Am 2009;93:569-82.

48. Lin J, Hu FB, Qi L and Curhan GC. Genetic polymorphisms of angiotensin-2 type 1 receptor and angiotensinogen and risk of renal dysfunction and coronary heart disease in type 2 diabetes mellitus. BMC Nephrol 2009;10:9.

49. Chang HR, Cheng CH, Shu KH, Chen CH, Lian JD, Wu MY. Study of the polymorphism of angiotensinogen, anigiotensin-converting enzyme and angiotensin receptor in type II diabetes with end-stage renal disease in Taiwan. J Chin Med Assoc 2003;66:51-6.

50. Ezzidi I, Mtiraoui N, Kacem M, Chaieb M, Mahjoub T, Almawi WY. Identification of specific angiotensin-converting enzyme variants and haplotypes that confer risk and protection against type 2 diabetic nephropathy. Diabetes Metab Res Rev 2009;25:717-24.

51. van Ittersum FJ, de Man AM, Thijssen S, de Knijff P, Slagboom E, Smulders Y, Tarnow L, Donker AJ, Bilo HJ, Stehouwer CD. Genetic polymorphisms of the renin-angiotensin system and complications of insulin-dependent diabetes mellitus. Nephrol Dial Transplant 2000;15:1000-7.

52. Mitchell KD, Navar LG. Intrarenal actions of angiotensin II in the pathogenesis of experimental hypertension, in hypertension: pathophysiology, diagnosis and management In: Laragh JH, Brenner BM, editors. New York: Raven Press; 1995. pp. 1437-50.

53. Navar LG, Prieto-Carrasquero MC, Kobori H. Renal renin-angiotensin system. In: Kastin AJ, editor. Handbook of Biologically Active Peptides. Academic Press; 2006. pp. 1235-42.

54. Kobori H, Nangaku M, Navar LG, Nishiyama A. The intrarenal renin-angiotensin system: from physiology to the pathobiology of hypertension and kidney disease. Pharmacol Rev 2007;59:251-87.

55. Ingert C, Grima M, Coquard C, Barthelmebs M, Imbs JL. Contribution of angiotensin II internalization to intrarenal angiotensin II levels in rats. Am J Physiol Renal Physiol 2002;283:F1003-10.

56. Rosivall L, Navar LG. Effects on renal hemodynamics of intra-arterial infusions of angiotensins I and II. Am J Physiol 1983;245:F181-7.

57. Komlosi P, Fuson AL, Fintha A, Peti-Peterdi J, Rosivall L, Warnock DG, Bell PD. Angiotensin I conversion to angiotensin II stimulates cortical collecting duct sodium transport. Hypertension 2003;42:195-9.

58. Hackenthal E, Paul M, Ganten D, Taugner R. Morphology, physiology, and molecular biology of renin secretion. Physiol Rev 1990;70:1067-116.

59. Schnermann JB, Traynor T, Yang T, Huang YG, Oliverio MI, Coffman T, Briggs JP. Absence of tubuloglomerular feedback responses in AT1A receptor deficient mice. Am J Physiol 1997;273:F315-20.

60. Tarnow L, Cambien F, Rossing P, Nielsen FS, Hansen BV, Lecerf L, Poirier O, Danilov S, Parving HH. Lack of relationship between an insertion/deletion polymorphism in the angiotensin I converting enzyme gene and diabetic nephropathy and proliferative retinopathy in IDDM patients. Diabetes 1995;44:489-94.

61. Tarnow L, Cambien F, Rossing P, Nielsen FS, Hansen BV, Ricard S, Poirier O, Parving HH. Angiotensinogen gene polymorphisms in IDDM patients with diabetic nephropathy. Diabetes 1996;45:367-9.

62. Takahashi K, Yamamoto H, Hirose T, Hiraishi K, Shoji I, Shibasaki A, Kato I, Kaneko K, Sasano H, Satoh F, Totsune K. Expression of (pro)renin receptor in human kidneys with end-stage kidney disease due to diabetic nephropathy. Peptides 2010;31:1405-8.

63. Kostulas K, Brophy VH, Moraitis K, Manolescu A, Kostulas V, Gretarsdottir S, Cheng S, Hillert J. Genetic profile of ischemic cerebrovascular disease and carotid stenosis. Acta Neurol Scand 2008;118:146-52.

64. Chiang FT, Hsu KL, Tseng CD, Lo HM, Chern TH, Tseng YZ. Association of the renin gene polymorphism with essential hypertension in a Chinese population. Clin Genet 1997;51:370-4.

65. Sun B, Williams JS, Pojoga L, Chamarthi B, Lasky-Su J, Raby BA, Hopkins PN, Jeunemaitre X, Brown NJ, Ferri C, Williams GH. Renin gene polymorphism: its relationship to hypertension, renin levels and vascular responses. J Renin Angiotensin Aldosterone Syst 2011;12:564-71.

66. Purkait P, Suthar PC, Purohit VK, Naidu JM, Sarkar BN. Renin- Angiotensin- Aldosterone System gene polymorphisms in Type 2 Diabetic patients among the Mewari population of Rajasthan. Int J Biol Med Res 2013;4:3128-34.

67. Purkait Pulakes, Raychodhury P, Bandhyopadhya S, Naidu JM, Sarkar BN. Analysis of Aldosterone Synthase Gene Promoter (-344 C>T) Polymorphism in Indian Diabetic Nephropathy Patients. J Diabetes Metab 2013;4:271.

68. Prasad P, Tiwari AK, Kumar KM, Ammini AC, Gupta A, Gupta R, Sharma AK, Rao AR, Nagendra R, Chandra TS, Tiwari SC, Rastogi P, Gupta BL, Thelma BK. Cronic renal insuffiency among Asian Indians with type 2 diabetes: I Role of RAAS gene polymorphisms. BMC Med Genet 2006;7:42.

69. Berge KE, Berg K. No effect of a BglI polymorphism at the renin (REN) locus on blood pressure level or variability. Clin Genet 1994;46:436-8.

70. Chiang FT, Hsu KL, Tseng CD, Lo HM, Chern TH, Tseng YZ. Association of the renin gene polymorphism with essential hypertension in a Chinese population. Clin Genet 1997;51:370-4.

71. Mtiraoui N, Ezzidi I, Turki A, Chaieb M, Mahjoub T, Almawi WY. Renin-angiotensin-aldosterone system genotypes and haplotypes affect the susceptibility to nephropathy in type 2 diabetes patients. J Renin Angiotensin Aldosterone Syst 2011;12:572-80.

72. Germain S, Philippe J, Fuchs S, Lengronne A, Corvol P, Pinet F. Regulation of human renin secretion and gene transcription in Calu-6 cells. FEBS Letters 1997;407:177-183.

Cite This Article

Original Article
Open Access
Genetic variants of renin on the prevalence of diabetic nephropathy
Pulakes PurkaitPulakes  Purkait, ... Biswanath Sarkar

How to Cite

Purkait P, Halder K, Naidu JM, Sarkar B. Genetic variants of renin on the prevalence of diabetic nephropathy. Vessel Plus. 2018;2:19. http://dx.doi.org/10.20517/2574-1209.2018.16

Download Citation

If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click on download.

Export Citation File

Type of Import

Tips on Downloading Citation

This feature enables you to download the bibliographic information (also called citation data, header data, or metadata) for the articles on our site.

Citation Manager File Format

Use the radio buttons to choose how to format the bibliographic data you're harvesting. Several citation manager formats are available, including EndNote and BibTex.

Type of Import

If you have citation management software installed on your computer your Web browser should be able to import metadata directly into your reference database.

Direct Import: When the Direct Import option is selected (the default state), a dialogue box will give you the option to Save or Open the downloaded citation data. Choosing Open will either launch your citation manager or give you a choice of applications with which to use the metadata. The Save option saves the file locally for later use.

Indirect Import: When the Indirect Import option is selected, the metadata is displayed and may be copied and pasted as needed.

Data & Comments

Data

Views
11054
Downloads
2154
Citations
2
Comments
0
19

Comments

Comments must be written in English. Spam, offensive content, impersonation, and private information will not be permitted. If any comment is reported and identified as inappropriate content by OAE staff, the comment will be removed without notice. If you have any queries or need any help, please contact us at [email protected].

Vessel Plus
ISSN 2574-1209 (Online)
Follow Us

Portico

All published articles are preserved here permanently:

https://www.portico.org/publishers/oae/

Portico

All published articles are preserved here permanently:

https://www.portico.org/publishers/oae/